|
Dear Farzana,
Hope you won't mind my
resorting to the first name basis. I have read so many of your writings
on this and other websites that it seems to me as if I personally know
you.
Thanks for your
response. It told me that you read what I wrote in its entirety. I
take that as a compliment. I am not a skilled writer like you are and I
haven't learnt the art of brevity yet. Usually, it requires an effort to
read my long winding disjointed arguments. You made that effort and it
means a lot to me.
Following are my
thoughts on the issues you raised in the order of my choosing.
You wrote:
It
all leads to First Causes which the ancient philosophers were
preoccupied with as well. That is why, every one in the final analysis
only speaks about God, but I can understand your frustration, given the
viewpoint you espouse.
You can't make me read
philosophy, not even under a dire threat. That includes the
"evolutionary" philosophers. Its not that I have some sort of disdain
for it. Its just a statement of my ineptitude. I can't seem to go beyond
the first chapter of any philosophy book. However, considering the
topics of my interest, its hard to avoid philosophy altogether. Yes, I
am aware of the argument of first cause but it doesn't convince me
because it doesn't follow its own line of reasoning beyond a certain
point. I'm sure that you know what I mean. Similarly, I am aware of the
argument of intelligent design and that doesn't convince me as well
because it doesn't answer my questions about the flaws in the design. It
doesn't tell me why cave salamanders are born with eyes that they can't
see with. It doesn't tell me why males in most mammal species have
breast nipples. It doesn't tell me why the optical nerves in human eyes
are wired backward. Theory of natural selection answers all those
questions. To quote Theodosius Dobzhansky "Nothing in biology makes
sense except in the light of evolution". I don't get frustrated by
philosophy. Philosophy and I have learned to coexist together without
bothering each other.
All
of DNA has not been deciphered, which is why most of it appears to be
nonsense. It may not actually be nonsense. At least that is what I have
heard and I could be totally mistaken in my understanding of the issue.
Human genome project
took 12 years to complete but it did complete and decoded two third of
human DNA. Most of it (almost 70%) is scientifically demonstrable junk
or non-coding DNA. But that doesn't refute your point that all of the
DNA is not deciphered. Two third is not all. It doesn't have to be
deciphered fully to prove the existence of junk DNA. The idea of the
junk DNA was formed because of a simple observation that amount of DNA
per cell in an organism can vary widely between closely related
organisms without showing any significant variation in the phenotype.
Later when the structure of the DNA was discovered, it became clear that
genes are not exactly continuous chunks of DNA code. There is something
called "exons" in DNA that breaks the sequence and provides the address
of the location where rest of the code resides. From the exon to the
next chunk, the intermediate DNA code is not being used. Which meant
that you don't need to read all the DNA to decide whether there is junk
DNA or not. All you need to do is to read all the exons (a fixed
combination of nucleotides and thus easily detectable) to see which
memory locations in the DNA are used and which aren't.
A 100 GB hard disk in a
computer has 100 billion bytes in it and every one of those bytes has a
unique corresponding memory address. I can ask a computer engineer to
tell me what memory locations are in use and what are not. A dumb
engineer would develop an algorithm that will go to each byte and check.
That's not only an inefficient method, it will also produce wrong
information. That's the analogy of deciphering the entire DNA to see
what's being used and what's not. A smart engineer would write an
algorithm that will only look at the file allocation table of the hard
disk (like a catalog in a library) and see the mapping of locations
against files. That will tell him which memory locations are in use.
Similarly, I can ask the smart engineer to tell me if the location 127
is being used or not. He will again look at the allocation table to see
if there is a file that is pointing to the memory location 127. That
allocation table is created using something very similar to exons in the
operating system of the computer and that is how genetic engineers look
at the exons to determine what is junk and what is not.
One can say that the
junk DNA may have some past or future use but that doesn't change the
fact that its currently junk. I can't explain the entire thing without
getting into the nitty-gritty and I can't do that in an email. I'd
rather you read
DNA : The Secret of Life by James Watson. Its not written like a
science textbook and is very accessible.
But lets say, for the
sake of argument, I concede the point and say that one should not
postulate any facts unless the entire DNA is deciphered. I would happily
agree to that because that's not the only design flaw that I know of.
But it also means that Mr. Harun Yahya can also not base any arguments
on the basis of the information in DNA unless its proven that what
scientists consider junk today is really junk or not. That just makes
DNA an inadmissible evidence in the trial of creationism vs. evolution.
Also, mutations, on Which the evolutionary theory rests, are known to be
harmful, not beneficial to the advancement of species.
Mutation are not what
the theory of evolution rests upon. Its rest upon the concept of natural
selection. I don't blame you for that misstatement. The theory of
evolution is the most misrepresented scientific theory by friends and
foes alike. I myself am guilty of that.
Here is an
oversimplified hypothetical genetic code of an imaginary gene
ATCGGCATCGCGGCATATGCCG
If I replace the last
two letters (CG) with AT, its a mutation. Is it beneficial or harmful?
See the absurdity of the question? Who will decide whether its a good
mutation or a bad one? Try coming up with a different answer than
"Natural Selection". In and of itself, the mutation is neither good nor
bad. Its just an error in copying.
As for mutations being
harmful, let me modify your statement a little to make it more factual.
Most mutations are neutral (have no discernable effects), a large number
are harmful, some rare ones that are good and some that can't be
categorized as good or bad (example: sickle cell anemia in humans;
decreases efficiency of the body; increases resistance to Malaria).
You maintain that
mutation in a complex organism has a very low likelihood of being
beneficial. Complex is a vague term and begs definition. That definition
varies by perception. I
don't see any problem in the mutations in the complex organisms. Some
examples of mutations in humans are sickle cell anemia and lactose
tolerance. The more fantastic example is a mutant gene that
immunes the body from HIV. Some people have been identified to have a
mutant allele CCR5 gene that suppresses protein on the surface of
T-cells making the individual resistant to HIV infection. One of the
examples of the mutations in humans that's most interesting is that
people in a community near Milan, Italy don't get atherosclerosis
because of a mutant gene. What makes it more interesting then the rest
is the individual who was the source of this mutation was identified.
How small mutations
cause a sea change over a long period of time using cumulative selection
is the main topic of
Richard Dawkins' book
The Blind Watchmaker. I would request, rather beg, that you read it.
Next point. You wrote:
you
gave the example of how a book containing meaningful info could appear
as a result of feeding your computer with the raw material, such as
words, letters etc. Are you not debunking your own theory by suggesting
this? When we speak of evolution and creation, the main issue we must
address is whether or not there is intelligent intervention in the
process. Evolution ignores intelligent intervention whereas Creationism
acknowledges it. By giving the example of the computer and your
intelligent intervention in the process, which requires
you to feed the info, you are refuting your own viewpoint.
If you read my book
crunching algorithm example again, you will see that I did point to that
problem in the analogy. I wrote:
"Creationists at this
point like to talk about the intelligence of the process. Well, that’s a
whole another debate. I just wanted to tackle the claim that a book
can’t come about without an intelligent author thru a blind process and
the process that wrote those books is not intelligent by any definition
of the word. If that process is intelligent than the odometer in my car
is also intelligent."
It is entirely a
separate debate. All I was trying to do was to demonstrate that a blind
process can produce a book without having any intelligence pertaining
to the content of the book. I think you'd agree that the process
itself is blind. Your point is that its my intelligent intervention that
produced that process to analogize a process that, according to my point
of view, doesn't show any intelligence. That is absolutely true that my
analogy was rigged but I had to rig the process with my intelligent
intervention due to a simple fact that I didn't have 4 billion years and
the resources available to nature to demonstrate my point. What if I ask
you for a wager that I can produce a person who can win 10 consecutive
coin tosses? Its improbable but not impossible. Your natural tendency,
based on the improbability, would very likely to be to take me up on my
claim. If you do, you better hope that I don't have 1024 people on my
disposal 'coz if I have, the improbability disappears. I will divide
those 1024 people into 512 teams of two players each who would toss a
coin among them. The 512 winners will advance to the next group while
the losers will be shot and buried on the spot. Those 512 players will
be divided into 256 teams, winners advance, losers die. So, there'll be
128 winners and then 64, 32, 16, 8, 4 and eventually 2. These two
remaining players will toss a coin and whoever wins this time is the
person who has won 10 consecutive coin tosses. Is it a blind process?
Sure, the process didn't know who's going to be the person who will win
this tournament. Was there intelligence intervention? Yes, I did come up
with the idea of the teams. Why? Just to provide a shortcut. The
intelligence was a mean to demonstrate a point in a limited time. If I
am not limited by time, I will take one person and ask him to start
tossing the coin. If he does nothing but tosses the coin for a huge
amount of time, he will have 10 consecutive wins sometime. The
intelligence intervention is not needed with huge time and resource
availability. Lets suppose that winning 10 coin tosses is a trait that
helps a species to survive and whoever doesn't show that trait is
eliminated by natural selection in the way we shot our losers in the
tournament. Also suppose that every person in the human population of 6
billion people in the world represents a species. Everyone tosses the
coin ten times, calls it and if s/he loses, the nature suffocates
him/her to death. Only the people who win 10 consecutive times survive.
Statistically, by the end of the this exercise, almost 6 million
people/species will be left alive and those are the ones that passed the
test of natural selection. There is no intelligence involved. But then
who decides that 10 consecutive coin tosses is a trait that helps the
species to survive? My answer: environmental parameters. But who sets
those parameters? To you, God, to me, chance and my explanation of chance
follows.
There is a whole
continuum of variable environmental parameters and we see the example of
every point on that continuum in our universe. Just within our own solar
system, we have planets that are colder than ice and a planet whose
surface is one huge ocean of sulfuric acid. Within our own galaxy, there
are heavenly bodies with so little gravity that they won't keep a sumo
wrestler down and bodies whose gravity even light can't escape. Along
that continuum, there is a point that is just right for our type of life
and on that point lies planet Earth; one in the millions of planets in
the universe. We are the winners of a cosmic lottery. As many winners of
ordinary lotteries think that God personally intervened to draw their
numbers, we like to think that there is an intelligent creator who set
the environmental parameters just right for us. Maybe in a distant
galaxy, there is a planet that has just the right environmental
parameters for another type of life, lets say a phosphoric life, where
maybe there is another Farzana Hassan asking another Rafi Aamer how was
it possible that just the right parameters were evolved to give way to
the glowing life of the planet.
That concludes the
first part of my response (I was not kidding when I said that I don't
know the art of brevity). I have to tend to some urgent business. When I
am back, I will write to you the second part addressing a very important
point that you raised.
Rafi
rafiaamer@comcast.net
|