RAFI AAMER

This is in response to Farzana Hassan's posting By Harun Yahya

 

 

Dear Farzana,

Hope you won't mind my resorting to the first name basis. I have read so many of your writings on this and other websites that it seems to me as if I personally know you.

Thanks for your response. It told me that you read what I wrote in its entirety. I take that as a compliment. I am not a skilled writer like you are and I haven't learnt the art of brevity yet. Usually, it requires an effort to read my long winding disjointed arguments. You made that effort and it means a lot to me.

Following are my thoughts on the issues you raised in the order of my choosing.

You wrote:

It all leads to First Causes which the ancient philosophers were preoccupied with as well.  That is why, every one in the final analysis only speaks about God, but I can understand your frustration, given the viewpoint you espouse.

You can't make me read philosophy, not even under a dire threat. That includes the "evolutionary" philosophers. Its not that I have some sort of disdain for it. Its just a statement of my ineptitude. I can't seem to go beyond the first chapter of any philosophy book. However, considering the topics of my interest, its hard to avoid philosophy altogether. Yes, I am aware of the argument of first cause but it doesn't convince me because it doesn't follow its own line of reasoning beyond a certain point. I'm sure that you know what I mean. Similarly, I am aware of the argument of intelligent design and that doesn't convince me as well because it doesn't answer my questions about the flaws in the design. It doesn't tell me why cave salamanders are born with eyes that they can't see with. It doesn't tell me why males in most mammal species have breast nipples. It doesn't tell me why the optical nerves in human eyes are wired backward. Theory of natural selection answers all those questions. To quote Theodosius Dobzhansky "Nothing in biology makes sense except in the light of evolution". I don't get frustrated by philosophy. Philosophy and I have learned to coexist together without bothering each other.

All of DNA has not been deciphered, which is why most of it appears to be nonsense. It may not actually be nonsense.  At least that is what I have heard and I could be totally mistaken in my understanding of the issue.

Human genome project took 12 years to complete but it did complete and decoded two third of human DNA. Most of it (almost 70%) is scientifically demonstrable junk or non-coding DNA. But that doesn't refute your point that all of the DNA is not deciphered. Two third is not all. It doesn't have to be deciphered fully to prove the existence of junk DNA. The idea of the junk DNA was formed because of a simple observation that amount of DNA per cell in an organism can vary widely between closely related organisms without showing any significant variation in the phenotype. Later when the structure of the DNA was discovered, it became clear that genes are not exactly continuous chunks of DNA code. There is something called "exons" in DNA that breaks the sequence and provides the address of the location where rest of the code resides. From the exon to the next chunk, the intermediate DNA code is not being used. Which meant that you don't need to read all the DNA to decide whether there is junk DNA or not. All you need to do is to read all the exons (a fixed combination of nucleotides and thus easily detectable) to see which memory locations in the DNA are used and which aren't. 

A 100 GB hard disk in a computer has 100 billion bytes in it and every one of those bytes has a unique corresponding memory address. I can ask a computer engineer to tell me what memory locations are in use and what are not. A dumb engineer would develop an algorithm that will go to each byte and check. That's not only an inefficient method, it will also produce wrong information. That's the analogy of deciphering the entire DNA to see what's being used and what's not. A smart engineer would write an algorithm that will only look at the file allocation table of the hard disk (like a catalog in a library) and see the mapping of locations against files. That will tell him which memory locations are in use. Similarly, I can ask the smart engineer to tell me if the location 127 is being used or not. He will again look at the allocation table to see if there is a file that is pointing to the memory location 127. That allocation table is created using something very similar to exons in the operating system of the computer and that is how genetic engineers look at the exons to determine what is junk and what is not.

One can say that the junk DNA may have some past or future use but that doesn't change the fact that its currently junk. I can't explain the entire thing without getting into the nitty-gritty and I can't do that in an email. I'd rather you read DNA : The Secret of Life by James Watson. Its not written like a science textbook and is very accessible.

But lets say, for the sake of argument, I concede the point and say that one should not postulate any facts unless the entire DNA is deciphered. I would happily agree to that because that's not the only design flaw that I know of. But it also means that Mr. Harun Yahya can also not base any arguments on the basis of the information in DNA unless its proven that what scientists consider junk today is really junk or not. That just makes DNA an inadmissible evidence in the trial of creationism vs. evolution.

Also, mutations, on Which the evolutionary theory rests, are known to be harmful, not beneficial to the advancement of species.

Mutation are not what the theory of evolution rests upon. Its rest upon the concept of natural selection. I don't blame you for that misstatement. The theory of evolution is the most misrepresented scientific theory by friends and foes alike. I myself am guilty of that. 

Here is an oversimplified hypothetical genetic code of an imaginary gene

ATCGGCATCGCGGCATATGCCG

If I replace the last two letters (CG) with AT, its a mutation. Is it beneficial or harmful? See the absurdity of the question? Who will decide whether its a good mutation or a bad one? Try coming up with a different answer than "Natural Selection". In and of itself, the mutation is neither good nor bad. Its just an error in copying.

As for mutations being harmful, let me modify your statement a little to make it more factual. Most mutations are neutral (have no discernable effects), a large number are harmful, some rare ones that are good and some that can't be categorized as good or bad (example: sickle cell anemia in humans; decreases efficiency of the body; increases resistance to Malaria). 

You maintain that mutation in a complex organism has a very low likelihood of being beneficial. Complex is a vague term and begs definition. That definition varies by perception.  I don't see any problem in the mutations in the complex organisms. Some examples of mutations in humans are sickle cell anemia and lactose tolerance. The more fantastic example is a mutant gene that immunes the body from HIV. Some people have been identified to have a mutant allele CCR5 gene that suppresses protein on the surface of T-cells making the individual resistant to HIV infection. One of the examples of the mutations in humans that's most interesting is that people in a community near Milan, Italy don't get atherosclerosis because of a mutant gene. What makes it more interesting then the rest is the individual who was the source of this mutation was identified.

How small mutations cause a sea change over a long period of time using cumulative selection is the main topic of Richard Dawkins' book The Blind Watchmaker. I would request, rather beg, that you read it. 

Next point. You wrote:

you gave the example of how a book containing meaningful info could appear as a result of feeding your computer with the raw material, such as words, letters etc. Are you not debunking your own theory by suggesting this? When we speak of evolution and creation, the main issue we must address is whether or not there is intelligent intervention in the process. Evolution ignores intelligent intervention whereas Creationism acknowledges it. By giving the example of the computer and your intelligent intervention in the process, which requires you to feed the info, you are refuting your own viewpoint.

If you read my book crunching algorithm example again, you will see that I did point to that problem in the analogy. I wrote:

"Creationists at this point like to talk about the intelligence of the process. Well, that’s a whole another debate. I just wanted to tackle the claim that a book can’t come about without an intelligent author thru a blind process and the process that wrote those books is not intelligent by any definition of the word. If that process is intelligent than the odometer in my car is also intelligent."

It is entirely a separate debate. All I was trying to do was to demonstrate that a blind process can produce a book without having any intelligence pertaining to the content of the book. I think you'd agree that the process itself is blind. Your point is that its my intelligent intervention that produced that process to analogize a process that, according to my point of view, doesn't show any intelligence. That is absolutely true that my analogy was rigged but I had to rig the process with my intelligent intervention due to a simple fact that I didn't have 4 billion years and the resources available to nature to demonstrate my point. What if I ask you for a wager that I can produce a person who can win 10 consecutive coin tosses? Its improbable but not impossible. Your natural tendency, based on the improbability, would very likely to be to take me up on my claim. If you do, you better hope that I don't have 1024 people on my disposal 'coz if I have, the improbability disappears. I will divide those 1024 people into 512 teams of two players each who would toss a coin among them. The 512 winners will advance to the next group while the losers will be shot and buried on the spot. Those 512 players will be divided into 256 teams, winners advance, losers die. So, there'll be 128 winners and then 64, 32, 16, 8, 4 and eventually 2. These two remaining players will toss a coin and whoever wins this time is the person who has won 10 consecutive coin tosses. Is it a blind process? Sure, the process didn't know who's going to be the person who will win this tournament. Was there intelligence intervention? Yes, I did come up with the idea of the teams. Why? Just to provide a shortcut. The intelligence was a mean to demonstrate a point in a limited time. If I am not limited by time, I will take one person and ask him to start tossing the coin. If he does nothing but tosses the coin for a huge amount of time, he will have 10 consecutive wins sometime. The intelligence intervention is not needed with huge time and resource availability. Lets suppose that winning 10 coin tosses is a trait that helps a species to survive and whoever doesn't show that trait is eliminated by natural selection in the way we shot our losers in the tournament. Also suppose that every person in the human population of 6 billion people in the world represents a species. Everyone tosses the coin ten times, calls it and if s/he loses, the nature suffocates him/her to death. Only the people who win 10 consecutive times survive. Statistically, by the end of the this exercise, almost 6 million people/species will be left alive and those are the ones that passed the test of natural selection. There is no intelligence involved. But then who decides that 10 consecutive coin tosses is a trait that helps the species to survive? My answer: environmental parameters. But who sets those parameters? To you, God, to me, chance and my explanation of chance follows.

There is a whole continuum of variable environmental parameters and we see the example of every point on that continuum in our universe. Just within our own solar system, we have planets that are colder than ice and a planet whose surface is one huge ocean of sulfuric acid. Within our own galaxy, there are heavenly bodies with so little gravity that they won't keep a sumo wrestler down and bodies whose gravity even light can't escape. Along that continuum, there is a point that is just right for our type of life and on that point lies planet Earth; one in the millions of planets in the universe. We are the winners of a cosmic lottery. As many winners of ordinary lotteries think that God personally intervened to draw their numbers, we like to think that there is an intelligent creator who set the environmental parameters just right for us. Maybe in a distant galaxy, there is a planet that has just the right environmental parameters for another type of life, lets say a phosphoric life, where maybe there is another Farzana Hassan asking another Rafi Aamer how was it possible that just the right parameters were evolved to give way to the glowing life of the planet.

That concludes the first part of my response (I was not kidding when I said that I don't know the art of brevity). I have to tend to some urgent business. When I am back, I will write to you the second part addressing a very important point that you raised.

 Rafi  

rafiaamer@comcast.net

 


 

 
 

  Send questions or comments to Pervaiz Salahuddin